View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5172_low_3 (Length: 367)
Name: NF5172_low_3
Description: NF5172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5172_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 203 - 350
Target Start/End: Original strand, 27652919 - 27653066
Alignment:
| Q |
203 |
aaatatcaatagcattctacgaaaacacaattgtttgagaatttggctcataaaccgagttatttaattcaagaatggattaatgattgcatagtttcca |
302 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27652919 |
aaatatcaatagcattctagaaaaacatgattgtttaagaatttagctcataaactgagttatttaattcaagaatggattaatgattgcatagttccca |
27653018 |
T |
|
| Q |
303 |
cgcacaacgattcaaatctagaagattaatagtaattggtatagtacc |
350 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27653019 |
cgcacaatgattcaaatctagaagattattagtaattggtatagtacc |
27653066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 16 - 137
Target Start/End: Original strand, 11685385 - 11685505
Alignment:
| Q |
16 |
gatgaacacaagtgcaaataggcattggtcgatgagtattaagttcctccgaaagtcatttcatcttagtaaagtaatctaacacaaatttcgaaccttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
11685385 |
gatgaacacaagtgcaaataggcattggtcgatgagtattaagttcctccgaaattcatttcatcttagtaaagtaatctaacacaaatttcaaacc-tt |
11685483 |
T |
|
| Q |
116 |
gcttaagattgttgacagcaaa |
137 |
Q |
| |
|
|||||||| |||||| |||||| |
|
|
| T |
11685484 |
gcttaagactgttgatagcaaa |
11685505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 11715688 - 11715568
Alignment:
| Q |
16 |
gatgaacacaagtgcaaataggcattggtcgatgagtattaagttcctccgaaagtcatttcatcttagtaaagtaatctaacacaaatttcgaaccttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
11715688 |
gatgaacacaagtgcaaataggcattggtcgatgagtattaagttcctccgaaattcatttcatcttagtaaagtaatctaacacaaatttcaaacc-tt |
11715590 |
T |
|
| Q |
116 |
gcttaagattgttgacagcaaa |
137 |
Q |
| |
|
|||||||| |||||| |||||| |
|
|
| T |
11715589 |
gcttaagactgttgatagcaaa |
11715568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University