View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5172_low_8 (Length: 226)
Name: NF5172_low_8
Description: NF5172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5172_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 3902123 - 3901922
Alignment:
| Q |
13 |
gtgagatgaattcaagaaccaattccaaccactaacggttgaaatcaattgacattcatccctaatgctttttaatttcttattcttcgattttatactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
3902123 |
gtgagatgaattcaagaaccaattccaaccactaacggttgaaatcaattgacattcacccctaatgctttttaatttcataatcttcgattttatactt |
3902024 |
T |
 |
| Q |
113 |
ttgttatagttactttcaacaaatgataccaatacttcagtgtaaattttctatataaaatccattaaaatacttctgtcattcaatgaagtataatttg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3902023 |
ttgttatagttaccttcaacaaatgataccaatacttcagtgtaaattttctatataaaatccattaaaatacttctgtcattcaatgaaatataatttg |
3901924 |
T |
 |
| Q |
213 |
at |
214 |
Q |
| |
|
|| |
|
|
| T |
3901923 |
at |
3901922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 3904631 - 3904574
Alignment:
| Q |
13 |
gtgagatgaattcaagaaccaattccaaccactaacggttgaaatcaattgacattca |
70 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3904631 |
gtgagatgaattcaataaccaattccaaccactgaatgttgaaatcaattgacattca |
3904574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University