View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5173_high_9 (Length: 237)
Name: NF5173_high_9
Description: NF5173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5173_high_9 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 40466050 - 40465818
Alignment:
| Q |
1 |
ttgtactttagtgcttaatttatttatatactctctataacaaaatataagtaaaagcgggtcaaagaaatttgacgtatttggttcacctatatac--- |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40466050 |
ttgtactttagtgcttaatttatttatatactctctgtaacaaaatataagtaaaagcgagtcaaagaaatttgacgtatttgtttcacctatataccta |
40465951 |
T |
|
| Q |
98 |
----ataatatggtgtttagttctaaacttcgttgtattttgatatataaaaaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465950 |
tgatataatatggtgtttagttctaaacttcgttgtattttgatatataaaaaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtt |
40465851 |
T |
|
| Q |
194 |
tgatggggttgatttctcaagctgtttatgatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40465850 |
tgatggggttgatttctcaagctgtttatgatg |
40465818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 141 - 226
Target Start/End: Original strand, 21625299 - 21625384
Alignment:
| Q |
141 |
taaaaaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
21625299 |
taaaaaggtgtcaagaaatattgatttggtttatggaggaggcagcattggtttgatggggttggtttctcaagctgtttctgatg |
21625384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 145 - 226
Target Start/End: Complemental strand, 28271509 - 28271428
Alignment:
| Q |
145 |
aaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatg |
226 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||| | ||||| ||| |||| ||||||||| |||||| |
|
|
| T |
28271509 |
aaggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatg |
28271428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 226
Target Start/End: Original strand, 77216 - 77297
Alignment:
| Q |
145 |
aaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatg |
226 |
Q |
| |
|
||||| ||||| || ||||| || || ||||||||||| ||||||||| | ||||| || |||||||||||||| |||||| |
|
|
| T |
77216 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatg |
77297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 226
Target Start/End: Complemental strand, 40889068 - 40888987
Alignment:
| Q |
145 |
aaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatg |
226 |
Q |
| |
|
||||| ||||| || ||||| || || ||||||||||| ||||||||| | ||||| || |||||||||||||| |||||| |
|
|
| T |
40889068 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatg |
40888987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 82
Target Start/End: Original strand, 38462751 - 38462800
Alignment:
| Q |
33 |
ctctataacaaaatataagtaaaagcgggtcaaagaaatttgacgtattt |
82 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||| |||| |||||| |
|
|
| T |
38462751 |
ctctgtaacaaaatataagcaaaagcgagtcaaagaaagttgaggtattt |
38462800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University