View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5174-Insertion-4 (Length: 108)
Name: NF5174-Insertion-4
Description: NF5174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5174-Insertion-4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14569489 - 14569589
Alignment:
| Q |
8 |
atatggacccaattgttgctaccaaacaagcaaacaactcattataagcatgatcacacaatatgcttcatgttgagttgtgaaactttcacacacatta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
14569489 |
atatggacccaattgttgctaccaaacaagcaaacaactcattataagcatgatcacacaatatgcttcatgttgagatgtgaaaatttcacacacatta |
14569588 |
T |
|
| Q |
108 |
t |
108 |
Q |
| |
|
| |
|
|
| T |
14569589 |
t |
14569589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University