View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5174_high_16 (Length: 218)
Name: NF5174_high_16
Description: NF5174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5174_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 41298544 - 41298732
Alignment:
| Q |
12 |
catcatcactctctttatctcacaccctccttgttcctacattgtctaataagttaatgtctgtgagtcaaataactgaagaactcaattgtgtggtaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |
|
|
| T |
41298544 |
catcatcactctctttatctcacaccctccttgttcctacattgtctaataagttaatgtctgtgagtcaaataactgatgaactcaatcgtgtggtatt |
41298643 |
T |
 |
| Q |
112 |
gatgtactctacattttgtcttcttcaggatgtattcagcaagaagattattgggtgtggtactaagagaggggg-ctatactaccttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
41298644 |
gatgtactctacattttgtcttcttcaggatgtactcagcaagaagattattgggcgtggtactaagagagggggactatactaccttg |
41298732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 125 - 186
Target Start/End: Complemental strand, 525578 - 525517
Alignment:
| Q |
125 |
ttttgtcttcttcaggatgtattcagcaagaagattattgggtgtggtactaagagaggggg |
186 |
Q |
| |
|
|||||||||||||||||| | ||| ||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
525578 |
ttttgtcttcttcaggatattctcacgaaggagatcattgggcgtggtactaagagaggggg |
525517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University