View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5174_low_13 (Length: 290)
Name: NF5174_low_13
Description: NF5174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5174_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 2 - 272
Target Start/End: Original strand, 52374350 - 52374620
Alignment:
| Q |
2 |
ctactactactactcaataactgttccttcttattcaaacgctgttaaacaaaattaactcaactcaaccaattgtttctttttcttcaattaactatgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374350 |
ctactactactactcaataactgttccttcttattcaaacgctgttaaacaaaattaactcaactcaaccaattgtttctttttcttcaattaactatgt |
52374449 |
T |
|
| Q |
102 |
cggctcgcattgtagctgaagatgttcccgattcttattttgattttatggaaatggacgacttcacgcgccgccgtgacgccggtgatatgccgactct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374450 |
cggctcgcattgtagctgaagatgttcccgattcttatttcgattttatggaaatggacgacttcacgcgccgccgtgacgccggtgatatgccgactct |
52374549 |
T |
|
| Q |
202 |
cggacagcttctcaaacacgttggagatgtaaggaaagaagctatcggtgatggcagtgagacgccggtgc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52374550 |
cggacagcttctcaaacacgttggagatgtaaggaaagaagctattggtgatggcagtgagacgccggtgc |
52374620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University