View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5174_low_16 (Length: 219)
Name: NF5174_low_16
Description: NF5174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5174_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 56317077 - 56317273
Alignment:
| Q |
5 |
atggacatcatcaaataatcgaaatgcatgtggacttgctaatgctagggtataaaaaatattgaagtcatacactctcggccaatatcttaggtgctta |
104 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56317077 |
atggacctcataaaataatcgaaatgcatgtggacttgctaatgctagggtataaaaaatattgaagtcatacactctcggccaatatcttaggtgctta |
56317176 |
T |
 |
| Q |
105 |
tggctgaaactaggtaaatattttagtaattttaaagataaaactaggtaagttacttcaaatctgcacctaaagtagacactaacattgtgtgatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56317177 |
tggctgaaactaggtaaatattttagtaattttaaagataaaactaggtaagttacttcaaatctgcacctaaagtagacattaacattgtgtgatt |
56317273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University