View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5174_low_18 (Length: 213)
Name: NF5174_low_18
Description: NF5174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5174_low_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 26 - 213
Target Start/End: Original strand, 38096322 - 38096509
Alignment:
| Q |
26 |
ctacaacaaattccactactacccttgctgagaaactgaaacaaagagaagaaagaagggtcaacaatgtcaaagatagtaactatccaacgacgtcggc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38096322 |
ctacaacaaattccactactacccttgctgagaaactgaaacaaagagaagaaagaagggtcaacaatgtcaaagataataactatccaacgacgtcggc |
38096421 |
T |
|
| Q |
126 |
accatcgactacgtcgagtcgttactctgttttgctgcagctgatagcgtgtggaagttcaggtgcagagatgaaagcaaagcagcag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096422 |
accatcgactacgtcgagtcgttactctgttttgctgcagctgatagcgtgtggaagttcaggtgcagagatgaaagcaaagcagcag |
38096509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University