View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175-Insertion-13 (Length: 110)
Name: NF5175-Insertion-13
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175-Insertion-13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 32642172 - 32642070
Alignment:
| Q |
8 |
taaacttcctctatatttggggtcacacatactcattgggattaatggcacagttacctcctaaaataccaagtaccatacctcaaaattggccatattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32642172 |
taaacttcctctatatttggggtcacacatactcattgggattaatggcacagttacctcctaaaataccaagtaccataccccaaaattggccatattt |
32642073 |
T |
 |
| Q |
108 |
tcc |
110 |
Q |
| |
|
||| |
|
|
| T |
32642072 |
tcc |
32642070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University