View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_high_12 (Length: 273)
Name: NF5175_high_12
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 32061191 - 32061428
Alignment:
| Q |
18 |
tgattctgattctgggtattgaaaattttgttgtttttctgcatattcttagatttgctattggaaagttttggtttttgaagagaaattttgagaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061191 |
tgattctgattctgggtattgaaaattttgttgtttttctgcatattcttagatttgctattggaaagttttggtttttgaagagaaattttgagaaaga |
32061290 |
T |
 |
| Q |
118 |
aggaagagaaaaaataagcttatgatgcaacgtttggttgatcatgccattggtgtctctaaagagtaaggctatttga-nnnnnnnnnctatatgatgg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32061291 |
aggaagagaaaaaataagcttatgatgcaacgtttggttgatcatgccattggtgtctctaaagagtaaggctatttgattttttttttctatatgatgg |
32061390 |
T |
 |
| Q |
217 |
tagctgatgaatgcttttggtttttgaggaaatggtta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061391 |
tagctgatgaatgcttttggtttttgaggaaatggtta |
32061428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University