View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5175_high_20 (Length: 242)

Name: NF5175_high_20
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5175_high_20
NF5175_high_20
[»] chr7 (1 HSPs)
chr7 (5-139)||(28062871-28063007)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 5 - 139
Target Start/End: Original strand, 28062871 - 28063007
Alignment:
5 atgtcgaagaaaattatgtggtgaagtttgattacgtgctcgttttgcttcgtagaagtgatttcttgctcttcacggaaaaattagacaaag--ttttg 102  Q
    ||||| || |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||  |||||    
28062871 atgtccaaaaaaaatatgtggtgaagtttgattacgtgctcgttttgcttagtagaagtgatttcttgctcttcacggaaaaattagactaagttttttg 28062970  T
103 tttggttactaaaattagagcaagtttaactttaaga 139  Q
    |||||||||||||||||||| ||||||||||||||||    
28062971 tttggttactaaaattagagtaagtttaactttaaga 28063007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University