View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_high_24 (Length: 228)
Name: NF5175_high_24
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 73 - 211
Target Start/End: Original strand, 28673384 - 28673520
Alignment:
| Q |
73 |
atctttagatttttctggaacatttccatttgagacaaatggaaacttttctgtttatggagatggggttatgcctaaaattagacgtatatgtttttag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28673384 |
atctttagatttttctggaacatttccatttgagacaaatggaaacttttctgtttatggagatgg--ttatgcctaaaattagacgtatatgtttttag |
28673481 |
T |
|
| Q |
173 |
catttctcttagattaacattgtgtcattgtcataaaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28673482 |
catttctcttagattaacattgtgtcattgtcataaaac |
28673520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 37563910 - 37563946
Alignment:
| Q |
159 |
gtatatgtttttagcatttctcttagattaacattgt |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37563910 |
gtatatgttttcagcatttctcttagattaacattgt |
37563946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University