View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5175_low_12 (Length: 273)

Name: NF5175_low_12
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5175_low_12
NF5175_low_12
[»] chr6 (1 HSPs)
chr6 (18-254)||(32061191-32061428)


Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 32061191 - 32061428
Alignment:
18 tgattctgattctgggtattgaaaattttgttgtttttctgcatattcttagatttgctattggaaagttttggtttttgaagagaaattttgagaaaga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32061191 tgattctgattctgggtattgaaaattttgttgtttttctgcatattcttagatttgctattggaaagttttggtttttgaagagaaattttgagaaaga 32061290  T
118 aggaagagaaaaaataagcttatgatgcaacgtttggttgatcatgccattggtgtctctaaagagtaaggctatttga-nnnnnnnnnctatatgatgg 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||    
32061291 aggaagagaaaaaataagcttatgatgcaacgtttggttgatcatgccattggtgtctctaaagagtaaggctatttgattttttttttctatatgatgg 32061390  T
217 tagctgatgaatgcttttggtttttgaggaaatggtta 254  Q
    ||||||||||||||||||||||||||||||||||||||    
32061391 tagctgatgaatgcttttggtttttgaggaaatggtta 32061428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University