View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_low_13 (Length: 258)
Name: NF5175_low_13
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 2113985 - 2114226
Alignment:
| Q |
17 |
catcaaaccaaaactcaacctaccaagtttctcatagaacttttcaaggaaatttacctcatcagttgaatactcttttctttttcttcctcttatcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113985 |
catcaaaccaaaactcaacctaccaagtttctcatagaacttttcaaggaaatttacctcatcagttgaatactcttttctttttcttcctcttatcaaa |
2114084 |
T |
|
| Q |
117 |
atcattgcatcagataatggcaatggaggaaggtgaatggtatcatagttctttaccttggaaagccttgtagtaataataacatgagtccctcctgtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2114085 |
atcattgcatcagataatggcaatggaggaaggtgaatggtatcatagttttttaccttggatagccttgtagtaataataacatgagtccctcctgtgt |
2114184 |
T |
|
| Q |
217 |
tgtttttcggtatcaaatcatacagatcttttccttcccacc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2114185 |
tgtttttcggtatcaaatcatacagatcttttccttcccacc |
2114226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University