View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_low_17 (Length: 245)
Name: NF5175_low_17
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 7369607 - 7369835
Alignment:
| Q |
1 |
tgtttttaccattgttaaggaatgtctccttacaaacttgacactaaagttgttaaaatacagcaacgaactcaataaaaagagacgagatgtcgacaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7369607 |
tgtttttaccattgttaaggaatgtctccttacaaacttgacactaaagttgttaaagtatagcaacgaactcaataaaaagagacgagatgtcgacaat |
7369706 |
T |
|
| Q |
101 |
cagaaatcatggcaacaaacaaactcaataaaaagagaagagacgttgacactcggaaactatggcaacgaactcaaagaatccttctttgaagcttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7369707 |
cagaaatcatggcaacaaacaaactcaataaaaagagaagagacgttgacactcggaaactatggcaacgaactcaaataatccttctttgaagcttgaa |
7369806 |
T |
|
| Q |
201 |
agttacaactacttgcttgaaattctttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7369807 |
agttacaactacttgcttgaaattctttc |
7369835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University