View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_low_20 (Length: 242)
Name: NF5175_low_20
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 5 - 139
Target Start/End: Original strand, 28062871 - 28063007
Alignment:
| Q |
5 |
atgtcgaagaaaattatgtggtgaagtttgattacgtgctcgttttgcttcgtagaagtgatttcttgctcttcacggaaaaattagacaaag--ttttg |
102 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28062871 |
atgtccaaaaaaaatatgtggtgaagtttgattacgtgctcgttttgcttagtagaagtgatttcttgctcttcacggaaaaattagactaagttttttg |
28062970 |
T |
 |
| Q |
103 |
tttggttactaaaattagagcaagtttaactttaaga |
139 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28062971 |
tttggttactaaaattagagtaagtttaactttaaga |
28063007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University