View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5175_low_22 (Length: 234)
Name: NF5175_low_22
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5175_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 43299593 - 43299751
Alignment:
| Q |
1 |
aacaaatccaaaattatcacacaaatattgatacaaatggttaccacataaaatagacttacaaatgcatttgaataaaattgatcacttactaaacaac |
100 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43299593 |
aacaaagccaaaattatcactcaaatattgatacaaatgtttaccacataaaatatacttacaaatgcatttgaataaaattgatcacttacttaacaac |
43299692 |
T |
 |
| Q |
101 |
agaaaaagaaggattatcttgtaaagaaacaggatatgtctgcaggatcaaccagaagc |
159 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
43299693 |
agaataagaaggattatcttgtaaaggatcaggatatgtctgcatgatcaaccagaagc |
43299751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 219
Target Start/End: Original strand, 43299768 - 43299808
Alignment:
| Q |
179 |
catgaaacacaatcataaatataagtattcattaaaacaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43299768 |
catgaaacacaatcataaatataagtattcattaaaacaac |
43299808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University