View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5175_low_25 (Length: 228)

Name: NF5175_low_25
Description: NF5175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5175_low_25
NF5175_low_25
[»] chr3 (1 HSPs)
chr3 (73-211)||(28673384-28673520)
[»] chr2 (1 HSPs)
chr2 (159-195)||(37563910-37563946)


Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 73 - 211
Target Start/End: Original strand, 28673384 - 28673520
Alignment:
73 atctttagatttttctggaacatttccatttgagacaaatggaaacttttctgtttatggagatggggttatgcctaaaattagacgtatatgtttttag 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
28673384 atctttagatttttctggaacatttccatttgagacaaatggaaacttttctgtttatggagatgg--ttatgcctaaaattagacgtatatgtttttag 28673481  T
173 catttctcttagattaacattgtgtcattgtcataaaac 211  Q
    |||||||||||||||||||||||||||||||||||||||    
28673482 catttctcttagattaacattgtgtcattgtcataaaac 28673520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 37563910 - 37563946
Alignment:
159 gtatatgtttttagcatttctcttagattaacattgt 195  Q
    ||||||||||| |||||||||||||||||||||||||    
37563910 gtatatgttttcagcatttctcttagattaacattgt 37563946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University