View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-12 (Length: 79)
Name: NF5176-Insertion-12
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 14660354 - 14660284
Alignment:
| Q |
8 |
gtttgtgcagattgggaatgtctcaagagaaatcataaagtctatgctgcactggcttttcttctctctcg |
78 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
14660354 |
gtttgtgcagattgggagtgtctcaagagaaatcataaagtctatgctgcactggcttttcatctcgctcg |
14660284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 14670748 - 14670678
Alignment:
| Q |
8 |
gtttgtgcagattgggaatgtctcaagagaaatcataaagtctatgctgcactggcttttcttctctctcg |
78 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||| ||| || |||||||| || |||| |||| |
|
|
| T |
14670748 |
gtttgtgaagattgggagcgtctcaagagaaatcataaagtcgatgttgtactggcttctcatctcgctcg |
14670678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University