View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-17 (Length: 53)
Name: NF5176-Insertion-17
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 4e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 6452191 - 6452236
Alignment:
| Q |
8 |
aatcgtatatcctatcccattctttgcgttctccggttccatctcc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6452191 |
aatcgtatatcctatcccattctttgcgttctccggttccatctcc |
6452236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 53
Target Start/End: Original strand, 42694427 - 42694458
Alignment:
| Q |
22 |
tcccattctttgcgttctccggttccatctcc |
53 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
42694427 |
tcccattctttgcgttctcctgttccatctcc |
42694458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University