View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-20 (Length: 251)
Name: NF5176-Insertion-20
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 279099 - 279343
Alignment:
| Q |
7 |
acatcttaaaagactccatgctgccataaagttaggagagaaggttcgtaccaatggcactgctacttgggagagtcatggagattatttatggatgact |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
279099 |
acatcttaaaagactccatgctgccataaagttaggagagaaggttctcaccaatggcactgctacttgggagagtcatggagattctttatggatgact |
279198 |
T |
|
| Q |
107 |
acttatacaaataaggacactggacaaaaaatttgttttttgagtaattcacatacctctaaagatgctgaagttgatttacaacaagatggaaagtatt |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279199 |
acttatacaaataagggcactggacaaaaattttgttttttgagtaattcacatacctctaaagatgctgaagttgatttacaacaagatggaaagtatt |
279298 |
T |
|
| Q |
207 |
atgtttctgcttggtcaatgtcccttctccaagactgcaacaaag |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279299 |
atgttcctgcttggtcaatgtcccttctccaagactgcaacaaag |
279343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University