View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-21 (Length: 244)
Name: NF5176-Insertion-21
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 42662855 - 42662628
Alignment:
| Q |
17 |
gatgtgcagctgagtttctacaaatgagtgaggattatggagaaggaaacctaatgatacaaactgaaaatttccttaaccacatatttggtcaatggac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662855 |
gatgtgcagctgagtttctacaaatgagtgaagattatggagaaggaaacctaatgatacaaactgaaaatttccttaaccacatatttggtcaatggac |
42662756 |
T |
 |
| Q |
117 |
agacacactcaaggcactcaaaacatgtgaagaggttttacctttagctgaagagcttcacataacttcaagatgtatacattctttagttttgaaagct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662755 |
agacacactcaaggcactcaaaacatgtgaagatgttttacctttagctgaagagcttcacataacttcaagatgtatacattctttagttttgaaagct |
42662656 |
T |
 |
| Q |
217 |
gcagatccaactttggctatattacctc |
244 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
42662655 |
gcagatccaactttggctatcttacctc |
42662628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University