View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-22 (Length: 66)
Name: NF5176-Insertion-22
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 51
Target Start/End: Complemental strand, 43670195 - 43670157
Alignment:
| Q |
13 |
gtgcaccttggattgttcatacttgatctcattcatcca |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43670195 |
gtgcatcttggattgttcatacttgatctcattcatcca |
43670157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University