View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176-Insertion-24 (Length: 222)
Name: NF5176-Insertion-24
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176-Insertion-24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 46279238 - 46279024
Alignment:
| Q |
8 |
cgtacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279238 |
cgtacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttt |
46279139 |
T |
 |
| Q |
108 |
tggaatgttgtgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccacttt |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279138 |
tggaatgttatgtggtgaggtatcttcagaattttggaaacaatatttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccacttt |
46279039 |
T |
 |
| Q |
208 |
cttgtttgtttctgt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46279038 |
cttgtttgtttctgt |
46279024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University