View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_37 (Length: 281)
Name: NF5176_high_37
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 30462251 - 30461984
Alignment:
| Q |
1 |
caccctctggtctcttccaactctttgctgccaccctcctccaaccgaacacaatgcccttaaattccatgtagcggattaacctcaaaatagcagcgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30462251 |
caccctctggtctcttccaactctttgctgccaccctcctccaaccgaacacaatgcccttaaattccatgtagcggattaacctcaaaatagcaacgtg |
30462152 |
T |
 |
| Q |
101 |
tgttcaaatactgaagaaacaattgaagtacgtgcactaatgtcaaacattacatgaatgaacaatagaaggattatactatgcaccacctactagtggt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30462151 |
tgttcaaatattgaagaaacaattgaagtacatgcactaatgtcaaacattacatgaatgaacaatagaaggattatactatgcaccacctactagtggt |
30462052 |
T |
 |
| Q |
201 |
gcatagatacaccagaggggtaaaatgcttcctccttccaccctctaccttcccagctcccccgccct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30462051 |
gcatagatacaccagaggggtaaaatgcttcctccttccaccctctaccttcccagctcccccgccct |
30461984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 37 - 261
Target Start/End: Complemental strand, 30462473 - 30462253
Alignment:
| Q |
37 |
tcctccaaccgaacacaatgcccttaaattccatgtagcggattaa-cctcaaaatagcagcgtgtgttcaaatactgaagaaacaattgaagtacgtgc |
135 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||||||||||| |||||||| | || |||||||| |||| ||| ||||||||||| ||| |
|
|
| T |
30462473 |
tcctcctacccaacacaatgctcttaaattccatgtagcggattaaacctcaaaacac------gtattcaaatattgaacaaataattgaagtacatgc |
30462380 |
T |
 |
| Q |
136 |
actaatgtcaa-acattacatgaatgaacaatagaaggattatactatgcaccacctactagtggtgcatagatacaccagaggggtaaaatgcttcctc |
234 |
Q |
| |
|
||||||||||| | |||||||||| ||| ||||||||| |||||||||||||||||||||||| ||||||| ||||||||| || |||||||||||| |
|
|
| T |
30462379 |
actaatgtcaacatattacatgaaggaataatagaagggttatactatgcaccacctactagtagtgcatatttacaccagaaaggctaaatgcttcctc |
30462280 |
T |
 |
| Q |
235 |
cttccaccctctaccttcccagctccc |
261 |
Q |
| |
|
||||||||| ||||||||| ||||||| |
|
|
| T |
30462279 |
cttccaccccctaccttcctagctccc |
30462253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 30461987 - 30461951
Alignment:
| Q |
3 |
ccctctggtctcttccaactctttgctgccaccctcc |
39 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30461987 |
ccctctggtctctcccaactctttgctaccaccctcc |
30461951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University