View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_41 (Length: 271)
Name: NF5176_high_41
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 12309722 - 12309950
Alignment:
| Q |
18 |
accctcatgtaaatcaactcagaggaaaccctaatactgtagccctagaggtagaggtgttgggagaggaccctttaggccgggagaataattataaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
12309722 |
accctcatgtaaatcaactcagaggaaaccctaatattgtaaccctagaggtagaggtgttgggagaggaccctttaggccgggaggataa------agt |
12309815 |
T |
 |
| Q |
118 |
acactgatatacagtttttgtttggaacttatgcctataatacaagggttgccattaaaggtggcaatgctccttgcttatattttaacatctgaatgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12309816 |
acactgatatacagtttttgtttggaacttatgcctataatacaagggttgccattaaaggtggcaatgccccttgcttatattttaacatctgaatgct |
12309915 |
T |
 |
| Q |
218 |
acaacataatttagtgcaggaattgttacaagagg |
252 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
12309916 |
acaacataatttagtgcagggattgttacaagagg |
12309950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University