View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_48 (Length: 251)
Name: NF5176_high_48
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 25 - 233
Target Start/End: Complemental strand, 28203605 - 28203398
Alignment:
| Q |
25 |
cctttgcaaattaaaatgtcggttatcatagggtattttttaaaagtagtgtgtaatcttaaactaggcatataataagacagataaaataagtaatatt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28203605 |
cctttgcaaattaaaatgtcggttatcatagggtattttttaaaagtagtgtgtaatcttaaactaggcttataataagacagataaaataagtaatatt |
28203506 |
T |
 |
| Q |
125 |
ctttgttgtcaataatatgttaaatttgtccaacacatatagttgcgtgtcactcaaccataacttagagtttctgtgaatcacacgtgtcttggctttg |
224 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28203505 |
ttgtgttgtcaataatatgtt-aatttgtccaacacatatagttgcgtgtcactcaaccataacttagagtttctgtgaatcacacgtgtcttggctttg |
28203407 |
T |
 |
| Q |
225 |
cttctccct |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
28203406 |
cttctccct |
28203398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University