View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_51 (Length: 248)
Name: NF5176_high_51
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 28461961 - 28461721
Alignment:
| Q |
1 |
ttcacctattaggcatttgcaacctaactcaattattgtgatataagtagttaaggatttcacggttttcagcattgtatgtgggcggnnnnnnntaata |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28461961 |
ttcacctattagtcatttgcaacctaactcaattattgtgatataagtagttaaggatttcacggttttcagcattgtatgtgggcggaaaaaa-taata |
28461863 |
T |
 |
| Q |
101 |
atctaaagaagcatattgcttttttgacaataaaacaaagcataatatagtcgttatctgtcatttcttattatatttaatttaatttgctttaatatct |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28461862 |
atctaaagaagaatattgcttttttgacaataaaacaaagcataatatagtcgttatctgtcatttcttattatatttaatttaatttgctttaatatct |
28461763 |
T |
 |
| Q |
201 |
atctatacttctagtgttcataatgcatgcttagattttctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28461762 |
atctatacttctagtgttcataatgcatgcttagattttctt |
28461721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University