View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_52 (Length: 245)
Name: NF5176_high_52
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 33349158 - 33348933
Alignment:
| Q |
1 |
ccaaaattattaagattgtaccggtaataatgttgtacttgaatttacaaacgagtagtgttgtacttgattttggtgttttctcacttcaataatgtta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33349158 |
ccaaaattattaagattgtacgggtaataatgttatacttgaatttacaaacgagtagtgttgtacttgattttggtgttttctcacttcaataatgtta |
33349059 |
T |
 |
| Q |
101 |
cacatgaatttacaaacaagtgaagcagtgaaacaaaaaagacgtgttctattctacatgggcaaattggattccctg-cgtcaatgttataatcatttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
33349058 |
cacatgaatttacaaacaagtgaagcagtgaaacaaaaaagacgtgttctattctacatgggcaaattggattccctgccgtcaatgtcataatcatttt |
33348959 |
T |
 |
| Q |
200 |
ttaccgccttcaaaagtatgggtgag |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33348958 |
ttaccgccttcaaaagtatgggtgag |
33348933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University