View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5176_high_60 (Length: 240)

Name: NF5176_high_60
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5176_high_60
NF5176_high_60
[»] chr8 (1 HSPs)
chr8 (1-116)||(1517483-1517598)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 1517598 - 1517483
Alignment:
1 tgtgaggaaaataggttaaatttacatttcaagatagtttagttatcgatgagctaaaacatcaaatggaccattatcgttggcattattgaagcacttt 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
1517598 tgtgaggcaaataggttaaatttacatttcaagatagtttagttatcgatgagctaaaacatcaaatggaccattatggttggcattattgaagcacttt 1517499  T
101 gttccaatgtcatgat 116  Q
    ||||||||||||||||    
1517498 gttccaatgtcatgat 1517483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University