View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_high_66 (Length: 238)
Name: NF5176_high_66
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_high_66 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 50387560 - 50387765
Alignment:
| Q |
16 |
cacatacaaacttgtgcatacattagactcccaattgtcgatgcataaggaatcttctacatctcattttcttcaaagtcattcttagggcactgattga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
50387560 |
cacatacaaacttgtgcatacattagactcccaattgtcgatgcataaggaatcttctacatctcattttcttca-----------------ctgactga |
50387642 |
T |
|
| Q |
116 |
gactaaacttgtcacccttatctgcgggggtatctcatcgtttactgtcttgcatgtcttatctcttgagaaaattttcaatatagtctttttgtgacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50387643 |
gactaaacttgtcacccttatctgcgggggtatctcatcgtttactgtcttgcatgtcttatctcttgagaaaattttcaatatagtctttttgtgacaa |
50387742 |
T |
|
| Q |
216 |
tccaataatactctgagaacaat |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50387743 |
tccaataatactctgagaacaat |
50387765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University