View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_low_22 (Length: 329)
Name: NF5176_low_22
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 89 - 226
Target Start/End: Original strand, 33113889 - 33114025
Alignment:
| Q |
89 |
ctctttaaaccatagatttcagtggcacatggagtaaaggtttgtttgacacggagaaaaatcacttttatattcttttgtttaaaggagaaaatcactt |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33113889 |
ctctttaaaccatagattttggtggcacatggagtaaaggtttatttgacacggagaaaa-tcacttttatattcttttgtttaaaggagaaaatcactt |
33113987 |
T |
 |
| Q |
189 |
ttacttacaaattttttatccgtttgttatcgtctttc |
226 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33113988 |
ttacttagaaattttttatccgtttgttatcgtctttc |
33114025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 33113787 - 33113839
Alignment:
| Q |
1 |
gagaattgaatgagagaatcatattggaaaaatgcaactactacttgattgtt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33113787 |
gagaattgaatgagagaatcatattggaaaaatgcagctactacttgattgtt |
33113839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University