View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_low_35 (Length: 282)
Name: NF5176_low_35
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 263
Target Start/End: Complemental strand, 3245212 - 3244958
Alignment:
| Q |
9 |
gagtgagatgaatggttcttgctctaaactcaaaaccacaagacaagtgtaaagagttttattcaagtacttagatagtatcaaaatatggataatgagg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245212 |
gagtgaaatgaatggttcttgctctaaactcaaaaccacaagacaagtgtaaagagttttattcaagtacttagatagtatcaaaatatggataatgagg |
3245113 |
T |
 |
| Q |
109 |
ataaattgtagtttagtagtattgtaggctggtatcaccgaaagtgaagaaaatttacttccgacgtttggattgccatatttgagtttatctctttgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245112 |
ataaattgtagtttagtagtattgtaggctggtatcaccgaaagtgaagaaaatttacttacgacgtttggattgccatatttgagtttatctctttgta |
3245013 |
T |
 |
| Q |
209 |
taagcacttggagattatttcggagagcttattaaacaaccaatgacatgtccat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245012 |
taagcacttggagattatttcggagagcttattaaacaaccaatgacatgtccat |
3244958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University