View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_low_38 (Length: 277)
Name: NF5176_low_38
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 5052130 - 5052371
Alignment:
| Q |
20 |
gcgtttacaggaatgtgagtttggattggaatattcagtgaacattgaagacaatagtaccttggtttcaaatgttttatggtcatgacgtaggcatgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5052130 |
gcgtttacaggaatgtgagtttggattggaa-attcagtgaacatttaagacaatagtaccttggtttcagatgttttatggtcatgacgtaggcatgat |
5052228 |
T |
|
| Q |
120 |
ctcatcaaatttggatatgttttaatgttttgcattgacttaactagtcaatgttnnnnnnnttgattataatatacaatatggatttcaaatatagtag |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5052229 |
ctcatcaaatttggatatgttttaatgctttgcattgacttaactagtcaatgttaaaaaatttgattataatatacaatatggctttcaaatatagtag |
5052328 |
T |
|
| Q |
220 |
ttaatatcaaatttgcacggtgatataacagggatgcccttca |
262 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5052329 |
ttaatatcaaatttgcacggtgctataacagggatgcccttca |
5052371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 155
Target Start/End: Original strand, 5048194 - 5048273
Alignment:
| Q |
76 |
gtaccttggtttcaaatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgttttgcatt |
155 |
Q |
| |
|
||||||| ||||||||||||| | || |||| | | ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5048194 |
gtaccttagtttcaaatgtttgactgttctgacttggtcatgatctcatcaaatttggatatgttttaatgctttgcatt |
5048273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 5048513 - 5048564
Alignment:
| Q |
218 |
agttaatatcaaatttgcacggtgatataacagggatgcccttcacttctgtg |
270 |
Q |
| |
|
||||||||||||||||||||||| || || ||||||||||||||||| |||| |
|
|
| T |
5048513 |
agttaatatcaaatttgcacggtccta-aatagggatgcccttcacttttgtg |
5048564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University