View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_low_62 (Length: 239)
Name: NF5176_low_62
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 34344813 - 34345024
Alignment:
| Q |
13 |
gagacatcaaggactagaaagtgaacatgatgatgaggtgcaacaaggcctaattgtgctcgaatcatctccacagcatcctctcctttcttcttgtctc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34344813 |
gagacatcaaggactagaaagtgaacatgatgatgaggtgcaacaaggcctaattgtgctcgaattctctccacagcatcctctcctttcttcttgtctc |
34344912 |
T |
|
| Q |
113 |
tagcagttaacactacactcagtcccaactcagcaaaacgtttcacaagagcaaacccaatgcccttgtttcctcctgtcaccaccgccaccgtctcctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344913 |
tagcagttaacactacactcagtcccaactcagcaaaacgtttcacaagagcaaacccaatgcccttgtttcctcctgtcaccaccgccaccgtctcctt |
34345012 |
T |
|
| Q |
213 |
cgaccaccacct |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34345013 |
cgaccaccacct |
34345024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University