View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5176_low_82 (Length: 202)
Name: NF5176_low_82
Description: NF5176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5176_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 48996669 - 48996833
Alignment:
| Q |
18 |
cttatatgtagtaagtatataatcaattggtaattaattattcacaactcaaatagagcacctgtagccagacagaatgtgatggaattcactcctatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48996669 |
cttatatgtagtaagtatataatcaattagtaattaattattcacaactcaaatagagcacctgtagccaga----atgtgatggaattcactcctatga |
48996764 |
T |
 |
| Q |
118 |
tctcaagctaccattcagtgcaatacttgtcatcatatactatgcatttaatgaatgaaacgcaatatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48996765 |
tctcaagctaccattcagtgcaatacttgtcatcatatactatgcatttaatgaatgaaacgcaatatt |
48996833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University