View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5177-Insertion-5 (Length: 120)
Name: NF5177-Insertion-5
Description: NF5177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5177-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 39670065 - 39669961
Alignment:
| Q |
8 |
ttatgatgaataataatactcctactaggctaccactacttggttttggtctttgttgtgttcctcgttactcgggctgttcctcatcctacgctcccgc |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39670065 |
ttatgatgaataataatactcctacta--------ctacttggttttggtctttgttgtgttcctcgttactcgggctgttcctcatcctacgctcccgc |
39669974 |
T |
|
| Q |
108 |
tgactccgacatg |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39669973 |
tgactccgacatg |
39669961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University