View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5177-Insertion-6 (Length: 240)
Name: NF5177-Insertion-6
Description: NF5177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5177-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 32865371 - 32865205
Alignment:
| Q |
8 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32865371 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcattacc |
32865272 |
T |
|
| Q |
108 |
gttctccccttttttcctccggcaaccctccttccgacgtttctctcctcttccgtcgccgttcgtc |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32865271 |
gttctccccttttttcctccggcgaccctccttccgacgtttctctcctcttccgccgccgttcgtc |
32865205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 174
Target Start/End: Original strand, 35246841 - 35247007
Alignment:
| Q |
8 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcacc |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35246841 |
cctacatcaccctcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgtgatgcctttcatggccgcatcact |
35246940 |
T |
|
| Q |
108 |
gttctccccttttttcctccggcaaccctccttccgacgtttctctcctcttccgtcgccgttcgtc |
174 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35246941 |
gttctccccttttttcctccagcgaccctccttccgaagtttctctcctcttccgtcgccgttcgtc |
35247007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 42237360 - 42237194
Alignment:
| Q |
8 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcacc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
42237360 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatagatgtagatgcttgttgtggtggtgcgatgcctttcatggcagcatcacc |
42237261 |
T |
|
| Q |
108 |
gttctccccttttttcctccggcaaccctccttccgacgtttctctcctcttccgtcgccgttcgtc |
174 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42237260 |
gttctccccttttttcctccgacgaccctccttccgacgtttctctcctcttccgtcgtcgttcgtc |
42237194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 21747255 - 21747353
Alignment:
| Q |
8 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21747255 |
cctacatcaccgtcctctcctccccttcacatccaaacaacaaccacatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcac |
21747353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 20490752 - 20490639
Alignment:
| Q |
6 |
cacctacatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatca |
105 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||| |||||||| | ||| || |
|
|
| T |
20490752 |
cacctacatcaccaacctcacctcctcttcacatccaaaaaactaccgcatcgatgtagatgcttgctgttatggtgcaatgtctttcatgactgcacca |
20490653 |
T |
|
| Q |
106 |
ccgttctccccttt |
119 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20490652 |
ccgttctccccttt |
20490639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 59 - 166
Target Start/End: Original strand, 27899710 - 27899816
Alignment:
| Q |
59 |
atgtagatgcttgctgtggtggtgcgatgcctttcatggccgcatcaccgttctccccttttttcctccggcaaccctccttccgacgtttctctcctct |
158 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |||||||| ||||| |||| |
|
|
| T |
27899710 |
atgtagatgtttgttgtggtggtgcgatgcctttcatggccgcattaccgttctcccc-cttttcctccggagaccctccatccgacgtctctcttctct |
27899808 |
T |
|
| Q |
159 |
tccgtcgc |
166 |
Q |
| |
|
| |||||| |
|
|
| T |
27899809 |
ttcgtcgc |
27899816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University