View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5177_low_10 (Length: 229)
Name: NF5177_low_10
Description: NF5177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5177_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 45143039 - 45142826
Alignment:
| Q |
1 |
gtagatatgacagatacaagaatgacattacaagtggctgtaaatctatcaaatgccccgccggaatagcaaaagacattttggtgaatgtcgacaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143039 |
gtagatatgacagatacaagaatgacattaaaagtggctgtaaatctatcaaatgccccgcccgaatagcaaaagacattttggtgaatgtcgacaaatt |
45142940 |
T |
 |
| Q |
101 |
cctcttcccagttgannnnnnnnngtaatggacataaaggaagatgatggtgcccctctcatattgagaagaccatttatgaagactgctcgaatgatga |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
45142939 |
cctcttcccagttga-atttttttgtaatggacataaaggaagatgatggtgcccctctcatattgagaagacaatttatgaagactgctcgtatgatga |
45142841 |
T |
 |
| Q |
201 |
tctgacatggatgatg |
216 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
45142840 |
t-tgacatggatgatg |
45142826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University