View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5177_low_11 (Length: 219)
Name: NF5177_low_11
Description: NF5177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5177_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 7499834 - 7499702
Alignment:
| Q |
16 |
attattcttcaataacagttcttaagtttctgtggctctgaagtctgatctaattgtttatatatggcactatctgttaatacatggctggctttagaat |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7499834 |
attattcttcaataacagttctaaagtttctgtggctctgaagtctgatctaattgtttatatat-gcactatctgttaatacatggctggttttagaat |
7499736 |
T |
 |
| Q |
116 |
gatgtctcagttttttatgtttcttgatcatgaa |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
7499735 |
gatgtctcagttttttatgtttctagatcatgaa |
7499702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 129
Target Start/End: Original strand, 8139028 - 8139134
Alignment:
| Q |
16 |
attattcttcaataacagttcttaagtttctgtggctctgaagtctgatctaattgttt-atatatggcactatctgttaatacatggctggctttagaa |
114 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| | ||||||||||| || |||| ||||||| ||||||||||||||| |||| ||| |
|
|
| T |
8139028 |
attattcttccgtaacagttctaaagtttctgtggctctca-------tctaattgttttatgtatg-cactatcagttaatacatggctgactttggaa |
8139119 |
T |
 |
| Q |
115 |
tgatgtctcagtttt |
129 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
8139120 |
ttatgtctcagtttt |
8139134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 146
Target Start/End: Original strand, 8139168 - 8139198
Alignment:
| Q |
116 |
gatgtctcagttttttatgtttcttgatcat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8139168 |
gatgtctcagttttttatgtttcttgatcat |
8139198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University