View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5179-Insertion-8 (Length: 317)
Name: NF5179-Insertion-8
Description: NF5179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5179-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 2 - 317
Target Start/End: Original strand, 28035585 - 28035900
Alignment:
| Q |
2 |
ccaacagctttaacacaaggtatgagcaaatcctcggagtcacctttttcgacaactttgagaaactgttccaccacagcttttgcagcaggggcagttg |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035585 |
ccaatagctttaacacaaggtatgagcaaatcctcggagtcacctttttcaacaactttgagaaactgttccaccacagcttttgcagcaggggcagttg |
28035684 |
T |
 |
| Q |
102 |
gtttgagagcagagcgtctcaattctgcatgttctgctgccacagatgttatttccatcaaagccattgctgaataatgttgcacatcatctgtaccctt |
201 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28035685 |
gtttgaaagcagaacgtctcaattctgcatgttctgctgccacagatgttatttccatcaaagccattgctgaataatgttgcacatcatcagtaccctt |
28035784 |
T |
 |
| Q |
202 |
ttccaacaaaaccgcgaaacacaaaagagctcttgattctgtaattgtatgacaaatagtaacatttcttctacacaattgccataaagctctagctgcc |
301 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035785 |
ttccaacaaaaccgcaaaacacaaaagagctcttgattctgtaattgtatgacaaatagtaacatttcttctacacaattgccataaagctctagctgcc |
28035884 |
T |
 |
| Q |
302 |
attgctttcatttgtg |
317 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28035885 |
attgctttcatttgtg |
28035900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University