View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5179_high_4 (Length: 236)
Name: NF5179_high_4
Description: NF5179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5179_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 31801891 - 31801785
Alignment:
| Q |
1 |
tcatcccatgaggaaccttaccctttattcaatttccaaaacaaaacacacaataagacttaactggttccactagaacatgcatatttgttttaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
31801891 |
tcatcccatgaggaaccttaccctttattcaatttccaaaacaaaatacacaataagactt-attgattccactagaacatgcatatttgttttaaacat |
31801793 |
T |
 |
| Q |
101 |
gttaacca |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
31801792 |
gttaacca |
31801785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University