View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5179_low_1 (Length: 474)
Name: NF5179_low_1
Description: NF5179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5179_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 7e-87; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 115 - 355
Target Start/End: Original strand, 15682182 - 15682427
Alignment:
| Q |
115 |
ccctagctaccaaggtttactcttttgatttcaagggtgtgtgatat-------cttcttcttctttattccatgcttatcatcatgctactttcttttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15682182 |
ccctagctaccaaggtttactcttttgatctcaagggtgtgtgatattcttcttcttcttcttctttattccatgcttatcatcatgctactttcatttc |
15682281 |
T |
|
| Q |
208 |
ttctcggggaattgaagctttatggtccgattgtttgctagatcaagcaagtctattatggttgcacttctctttatatatatatttctaattattgnnn |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15682282 |
ttctcggggaattgaagctttatggtccgattgtttgctagatcaagcaagtctattatggttgcacctctctttatatatatatttctaattatt--tt |
15682379 |
T |
|
| Q |
308 |
nnnnnnnnnngaagttttaatttgtgttacatatataaagtgtggaac |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15682380 |
tattttttttgaagttttaatttgtgttacatatataaagtgtggaac |
15682427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 185 - 292
Target Start/End: Complemental strand, 15592662 - 15592555
Alignment:
| Q |
185 |
tatcatcatgctactttcttttcttctcggggaattgaagctttatggtccgattgtttgctagatcaagcaagtctattatggttgcacttctctttat |
284 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||| || ||||| || |
|
|
| T |
15592662 |
tatcatcatgctactttcttctcttctcagggaattgaagcttaatggtccgattatttgctagatcaagcaagtctattatcgttacaactctctctac |
15592563 |
T |
|
| Q |
285 |
atatatat |
292 |
Q |
| |
|
|||||||| |
|
|
| T |
15592562 |
atatatat |
15592555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 15682075 - 15682114
Alignment:
| Q |
10 |
catcatcaatatctaataaggtcagcaccaaaacaattac |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15682075 |
catcatcaatatctaataaggtcagcaccaaaacaattac |
15682114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University