View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5180-Insertion-6 (Length: 319)
Name: NF5180-Insertion-6
Description: NF5180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5180-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 50559027 - 50559174
Alignment:
| Q |
8 |
atcagtaccacaaatgtagagaacattgtaacccctaagtcgacagtaacgagcataaacgtcggcactcaatacacctgttcaaaatcagaatcggaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50559027 |
atcagtaccacaaatgtagagaacattgtaacccctaagtcgacagtaacgagcataaacgtcggcactcaacacacctgttcaaaatcagaatcggaac |
50559126 |
T |
|
| Q |
108 |
caacaaattgtttaaatagaatcaaacgaaacgaattgtgattgaatt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
50559127 |
caacaaattgtttaaatagaatcaaacgagacgaattgcgattgaatt |
50559174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 197 - 319
Target Start/End: Original strand, 50559188 - 50559310
Alignment:
| Q |
197 |
agtttcaatcgaagtaagtgacatacatccaatgatgttgccgagatgaggaacgttgttaacataaggaagtgcactagtgatgaggatgttccgtttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50559188 |
agtttcaatcgaagtaagtgacatacatccaatgatgttgccgagatgaggaacgttgttgacataaggaagtgcacttgtgatgaggatgttccgtttt |
50559287 |
T |
|
| Q |
297 |
ccttccaccggaaccttcgccgc |
319 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50559288 |
ccttccaccggaaccttcgccgc |
50559310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 256
Target Start/End: Original strand, 29774922 - 29774958
Alignment:
| Q |
220 |
tacatccaatgatgttgccgagatgaggaacgttgtt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29774922 |
tacatccaatgatgttgccgagatgagggacgttgtt |
29774958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 29774742 - 29774798
Alignment:
| Q |
31 |
cattgtaacccctaagtcgacagtaacgagcataaacgtcggcactcaatacacctg |
87 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| | || || |||||||| ||||||| |
|
|
| T |
29774742 |
cattgtaacccctaagacgacagtatcgagcaaacacatcagcactcaacacacctg |
29774798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University