View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5180-Insertion-8 (Length: 98)
Name: NF5180-Insertion-8
Description: NF5180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5180-Insertion-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 6e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 22 - 98
Target Start/End: Original strand, 6357639 - 6357715
Alignment:
| Q |
22 |
aaataatatgtttgtcccaggttccttaatgcactaccattaacatttagtgtcaaagtattgttgtcaacctgttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6357639 |
aaataatatgtttgtcccaggttccttaatgcactaccattaacatttagtgtcaaagtattgttgtcaacatgttt |
6357715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University