View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5180_low_7 (Length: 239)
Name: NF5180_low_7
Description: NF5180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5180_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 3 - 109
Target Start/End: Original strand, 50558812 - 50558918
Alignment:
| Q |
3 |
tagacctccttatgaatagcatggtatctacacaaaaacaccgagaaaagacgattattgaaattctgctttaggagtaagcaagatgagtgtaaaacca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50558812 |
tagacctccttatgaatagcatggtatctacacaaaaaaaccgagaaaagacgattattgaaattctgctttaggagtaagcaagatgagtgtaaaacca |
50558911 |
T |
|
| Q |
103 |
ttgaatc |
109 |
Q |
| |
|
||||||| |
|
|
| T |
50558912 |
ttgaatc |
50558918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 140 - 223
Target Start/End: Original strand, 50558949 - 50559032
Alignment:
| Q |
140 |
ttgatagtacttgtcagcaatttgtttaggagaacaattctgttccaaagctctagtaataattggagtaccatactcatcagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50558949 |
ttgatagtacttgtcagcaatttgtttaggagaacaattctgttccaaagctctagtaacaattggagtaccatactcatcagt |
50559032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 50569071 - 50569104
Alignment:
| Q |
6 |
acctccttatgaatagcatggtatctacacaaaa |
39 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
50569071 |
acctccttattaatagcatggtatctacacaaaa |
50569104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University