View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5181-Insertion-3 (Length: 131)

Name: NF5181-Insertion-3
Description: NF5181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5181-Insertion-3
NF5181-Insertion-3
[»] chr5 (2 HSPs)
chr5 (8-131)||(7154024-7154147)
chr5 (89-131)||(7141335-7141377)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 2e-38; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 8 - 131
Target Start/End: Original strand, 7154024 - 7154147
Alignment:
8 aattgaagatgcaatatctaacccaatcttttgaactttacnnnnnnnnnnnnnaaatataaaaaatgtacacaatttgatatttcaggacgtatttgtt 107  Q
    |||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||    
7154024 aattgaagatgcaatatctaacccaatcttttgaactttactttttatttttttaaatataaaaaatgtacacaatttgatatttcaggacgtatttgtt 7154123  T
108 gctggaactgatacaacatcgaca 131  Q
    || |||||||||||||||||||||    
7154124 gccggaactgatacaacatcgaca 7154147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 89 - 131
Target Start/End: Original strand, 7141335 - 7141377
Alignment:
89 atttcaggacgtatttgttgctggaactgatacaacatcgaca 131  Q
    ||||||||| |||||||||||||||||||||||| ||||||||    
7141335 atttcaggatgtatttgttgctggaactgatacatcatcgaca 7141377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University