View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5181_high_2 (Length: 444)
Name: NF5181_high_2
Description: NF5181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5181_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 419; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 18 - 444
Target Start/End: Complemental strand, 5396321 - 5395895
Alignment:
| Q |
18 |
gacatcaacctacggcacaatcccaacctcaccgacaccaccaaaacttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396321 |
gacatcaacctacggcacaatcccaacctcaccaacaccaccaaaacttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgt |
5396222 |
T |
 |
| Q |
118 |
cgaccgtggaaaaccatgtttgatatccggtcactcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgca |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396221 |
cgaccgtggaaaaccatgttcgatatccggtcactcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgca |
5396122 |
T |
 |
| Q |
218 |
tgaactacactatggtgatgcttttgattttgtttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggcggcatggttgtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396121 |
tgaactacactatggtgatgcttttgattttgtttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggcggcatggttgtt |
5396022 |
T |
 |
| Q |
318 |
cttctacttcctccgtgatcagccggtgattttatggggtcggcttgttgatgatcgaattgtggttgttctcatggcgtttgttacggtggctttgttg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396021 |
cttctacttcctccgtgatcagccggtgattttatggggtcggcttgttgatgatcgaattgtggttgttctcatggcgtttgttacggtggctttgttg |
5395922 |
T |
 |
| Q |
418 |
cttcttacgcaagctactgttaatatt |
444 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5395921 |
cttcttacgcaagctactgttaatatt |
5395895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University