View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5181_high_5 (Length: 341)
Name: NF5181_high_5
Description: NF5181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5181_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 252 - 323
Target Start/End: Original strand, 40430310 - 40430381
Alignment:
| Q |
252 |
ctaatttttaactaatttctgacccagggtttgtgcccctccctctcttttgatggtttcatttgttcttag |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40430310 |
ctaatttttaactaatttttgacccagggtttgtgcccctccctctcttttgatggtttcatttgttcttag |
40430381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 91 - 228
Target Start/End: Complemental strand, 33512899 - 33512762
Alignment:
| Q |
91 |
cactaagtgcggtcgacaacaatcaagccataatattctatcataaaccattttttatcatnnnnnnnnnnnnnnnnnnnnntgaatagttttgatgaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33512899 |
cactaagtgcggtcgacaacaatcaagtcataatattctatcataaaccattttttatcatgaaaaaaataattaaaaaaaatgaatagttttgatgaaa |
33512800 |
T |
 |
| Q |
191 |
tcttaaattcaatccttatatattataacaaacagttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33512799 |
tcttaaattcaatccttatatattatgacaaacagttg |
33512762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University