View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5182-Insertion-13 (Length: 146)
Name: NF5182-Insertion-13
Description: NF5182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5182-Insertion-13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 43646929 - 43646791
Alignment:
| Q |
8 |
caactgattaaaacccacatcgaaaaccgtgagactcttcaacaacccaatctcggaaggtaaacatgacttaaacaaattgttcaagaaattgatttcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43646929 |
caactgattaaaacccacatcgaaaaccgtgagattcttcaacaacccaatctcggaaggtaaacatgacttaaacaaattgttcaagaaattgatttcg |
43646830 |
T |
 |
| Q |
108 |
tttaagttggacatgtttcctatactggaaggtatgcat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43646829 |
tttaagttggacatgtttcctatactggaaggtatgcat |
43646791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University